Buy article online - an online subscription or single-article purchase is required to access this article.
Download citation
Download citation
link to html
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-­ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Subscribe to Acta Crystallographica Section D: Biological Crystallography

The full text of this article is available to subscribers to the journal.

If you have already registered and are using a computer listed in your registration details, please email support@iucr.org for assistance.

Buy online

You may purchase this article in PDF and/or HTML formats. For purchasers in the European Community who do not have a VAT number, VAT will be added at the local rate. Payments to the IUCr are handled by WorldPay, who will accept payment by credit card in several currencies. To purchase the article, please complete the form below (fields marked * are required), and then click on `Continue'.
E-mail address* 
Repeat e-mail address* 
(for error checking) 

Format*   PDF (US $40)
   HTML (US $40)
   PDF+HTML (US $50)
In order for VAT to be shown for your country javascript needs to be enabled.

VAT number 
(non-UK EC countries only) 
Country* 
 

Terms and conditions of use
Contact us

Follow Acta Cryst. D
Sign up for e-alerts
Follow Acta Cryst. on Twitter
Follow us on facebook
Sign up for RSS feeds